2. Using any information gained today, translate the following nucleotide sequen...
✅ Перевірена відповідь на це питання доступна нижче. Наші рішення, перевірені спільнотою, допомагають краще зрозуміти матеріал.
2. Using any information gained today, translate the following nucleotide sequences and indicate if they could generate a functional TCR. TCR beta chain: TTGCACTTTGGAGCGGGCAAGATATCTTTAAGGAAACAAACGCGC TCR alpha chain: GATCCTTATGACCGAGCTCAGGTCCAACTCCAATTCCACGGACTTAGT